Review



guide ittm long ssdna production system v2  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    TaKaRa guide ittm long ssdna production system v2
    Guide Ittm Long Ssdna Production System V2, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+ittm+long+ssdna+production+system+v2/Guide-it+Long+ssDNA+Production+System+v2/pm41236144-346-49-55
    Average 95 stars, based on 92 article reviews
    guide ittm long ssdna production system v2 - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Produced:

    Article Title: Fibroblast-specific palladin drives kidney fibrosis via MRTF-SRF signaling.
    Article Snippet: The crRNAs targeting intron 11 (50-GGAAGGTTCGGACACCCATA-30) and intron 12 (50-GTCTCTCCTACTCACTAAGA-30) of the mouse Palld gene were designed using the online sgRNA design tool available at https://sg.idtdna.com/site/order/ designtool/index/CRISPR_CUSTOM and purchased from Integrated DNA Technologies (Coralville, IA, USA). .. Donor single-stranded DNA (ssDNA) was produced using the Guide-itTM Long ssDNA Production System v2 (TAKARA BIO, Kusatsu, Japan), with IDT-synthesized gBlocks Gene Fragments as templates. ..

    Article Title: Fibroblast‐specific palladin drives kidney fibrosis via MRTF – SRF signaling
    Article Snippet: The crRNAs targeting intron 11 (5′‐GGAAGGTTCGGACACCCATA‐3′) and intron 12 (5′‐GTCTCTCCTACTCACTAAGA‐3′) of the mouse Palld gene were designed using the online sgRNA design tool available at https://sg.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM and purchased from Integrated DNA Technologies (Coralville, IA, USA). .. Donor single‐stranded DNA (ssDNA) was produced using the Guide‐itTM Long ssDNA Production System v2 (TAKARA BIO, Kusatsu, Japan), with IDT‐synthesized gBlocks Gene Fragments as templates. ..

    Construct:

    Article Title: Cerebellar organoids model cell type-specific FOXP2 expression during human cerebellar development.
    Article Snippet: .. The donor construct sequence contained sequences encoding a flexible XTEN linker (Komor et al., 2016), a P2A peptide and mNeonGreen, surrounded by two homology arms (see Supplementary Materials and Methods), and was purchased as a double-stranded DNA gBlock (IDT). ssDNA copies of the repair construct were generated using the Guide-itTM Long ssDNA Production System v2 (Takara Bio, 632666). ..

    Article Title: Cerebellar organoids model cell type-specific FOXP2 expression during human cerebellar development
    Article Snippet: .. The donor construct sequence contained sequences encoding a flexible XTEN linker , a P2A peptide and mNeonGreen, surrounded by two homology arms (see ), and was purchased as a double-stranded DNA gBlock (IDT). ssDNA copies of the repair construct were generated using the Guide-itTM Long ssDNA Production System v2 (Takara Bio, 632666). ..

    Sequencing:

    Article Title: Cerebellar organoids model cell type-specific FOXP2 expression during human cerebellar development.
    Article Snippet: .. The donor construct sequence contained sequences encoding a flexible XTEN linker (Komor et al., 2016), a P2A peptide and mNeonGreen, surrounded by two homology arms (see Supplementary Materials and Methods), and was purchased as a double-stranded DNA gBlock (IDT). ssDNA copies of the repair construct were generated using the Guide-itTM Long ssDNA Production System v2 (Takara Bio, 632666). ..

    Article Title: Cerebellar organoids model cell type-specific FOXP2 expression during human cerebellar development
    Article Snippet: .. The donor construct sequence contained sequences encoding a flexible XTEN linker , a P2A peptide and mNeonGreen, surrounded by two homology arms (see ), and was purchased as a double-stranded DNA gBlock (IDT). ssDNA copies of the repair construct were generated using the Guide-itTM Long ssDNA Production System v2 (Takara Bio, 632666). ..

    Generated:

    Article Title: Cerebellar organoids model cell type-specific FOXP2 expression during human cerebellar development.
    Article Snippet: .. The donor construct sequence contained sequences encoding a flexible XTEN linker (Komor et al., 2016), a P2A peptide and mNeonGreen, surrounded by two homology arms (see Supplementary Materials and Methods), and was purchased as a double-stranded DNA gBlock (IDT). ssDNA copies of the repair construct were generated using the Guide-itTM Long ssDNA Production System v2 (Takara Bio, 632666). ..

    Article Title: Cerebellar organoids model cell type-specific FOXP2 expression during human cerebellar development
    Article Snippet: .. The donor construct sequence contained sequences encoding a flexible XTEN linker , a P2A peptide and mNeonGreen, surrounded by two homology arms (see ), and was purchased as a double-stranded DNA gBlock (IDT). ssDNA copies of the repair construct were generated using the Guide-itTM Long ssDNA Production System v2 (Takara Bio, 632666). ..



    Similar Products

    guide ittm long ssdna production system v2  (TaKaRa)
    95
    TaKaRa guide ittm long ssdna production system v2
    Guide Ittm Long Ssdna Production System V2, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+ittm+long+ssdna+production+system+v2/Guide-it+Long+ssDNA+Production+System+v2/pm41236144-346-49-55
    Average 95 stars, based on 1 article reviews
    guide ittm long ssdna production system v2 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    guide ittm long ssdna production system  (TaKaRa)
    95
    TaKaRa guide ittm long ssdna production system
    Guide Ittm Long Ssdna Production System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+ittm+long+ssdna+production+system+v2/Guide-it+Long+ssDNA+Production+System+v2/us12398193-461-6-11
    Average 95 stars, based on 1 article reviews
    guide ittm long ssdna production system - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    guide ittm long ssdna production kit  (TaKaRa)
    95
    TaKaRa guide ittm long ssdna production kit
    Fig. 4. Efficiency of knock-in genome editing using various sizes of dsDNA and <t>ssDNA</t> fragments through modified EP of two-cell-stage mouse BDF1×B6 embryos. (a) Left illustration of Ramp2-gRNA targeting the intron of the murine Ramp2 gene. The sequence recognized by the Ramp2-gRNA is highlighted in blue, and the protospacer adjacent motif sequence is highlighted in red. Arrows indicate the positions of the PCR primers (Table S5). Both 1.23 kb dsDNA and 1.23 knt ssDNA, as well as both 1.80 kb dsDNA and 1.80 knt ssDNA, were utilized. They consist of both 5′ and 3′ Ramp2 homology arms, and EGFP cDNA (Table S6). Right illustration of R26-gRNA targeting the intron of the murine Gt(ROSA)26Sor gene . Both 0.66 kb dsDNA and 0.66 knt ssDNA, as well as both 1.36 kb dsDNA and 1.36 knt ssDNA, were utilized (Table S6). (b) (c) Table summarizes the efficiency of various sizes of DNA fragments about knock-in genome editing in the Ramp2 and Gt(ROSA)26Sor locus in fertilized eggs and two-cell embryos. They were electroporated with 100 ng/ µL of dsDNA or 50 ng/µL of ssDNA along with 200 ng/µL of guide RNA and 50 ng/µL of Cas9 protein. Each experiment was conducted at least three times.
    Guide Ittm Long Ssdna Production Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+ittm+long+ssdna+production+system+v2/Guide-it+Long+ssDNA+Production+System+v2/pm39639057-261-12-17
    Average 95 stars, based on 1 article reviews
    guide ittm long ssdna production kit - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Fig. 4. Efficiency of knock-in genome editing using various sizes of dsDNA and ssDNA fragments through modified EP of two-cell-stage mouse BDF1×B6 embryos. (a) Left illustration of Ramp2-gRNA targeting the intron of the murine Ramp2 gene. The sequence recognized by the Ramp2-gRNA is highlighted in blue, and the protospacer adjacent motif sequence is highlighted in red. Arrows indicate the positions of the PCR primers (Table S5). Both 1.23 kb dsDNA and 1.23 knt ssDNA, as well as both 1.80 kb dsDNA and 1.80 knt ssDNA, were utilized. They consist of both 5′ and 3′ Ramp2 homology arms, and EGFP cDNA (Table S6). Right illustration of R26-gRNA targeting the intron of the murine Gt(ROSA)26Sor gene . Both 0.66 kb dsDNA and 0.66 knt ssDNA, as well as both 1.36 kb dsDNA and 1.36 knt ssDNA, were utilized (Table S6). (b) (c) Table summarizes the efficiency of various sizes of DNA fragments about knock-in genome editing in the Ramp2 and Gt(ROSA)26Sor locus in fertilized eggs and two-cell embryos. They were electroporated with 100 ng/ µL of dsDNA or 50 ng/µL of ssDNA along with 200 ng/µL of guide RNA and 50 ng/µL of Cas9 protein. Each experiment was conducted at least three times.

    Journal: Scientific reports

    Article Title: Efficient genome editing of two-cell mouse embryos via modified CRISPR/Cas electroporation.

    doi: 10.1038/s41598-024-81198-0

    Figure Lengend Snippet: Fig. 4. Efficiency of knock-in genome editing using various sizes of dsDNA and ssDNA fragments through modified EP of two-cell-stage mouse BDF1×B6 embryos. (a) Left illustration of Ramp2-gRNA targeting the intron of the murine Ramp2 gene. The sequence recognized by the Ramp2-gRNA is highlighted in blue, and the protospacer adjacent motif sequence is highlighted in red. Arrows indicate the positions of the PCR primers (Table S5). Both 1.23 kb dsDNA and 1.23 knt ssDNA, as well as both 1.80 kb dsDNA and 1.80 knt ssDNA, were utilized. They consist of both 5′ and 3′ Ramp2 homology arms, and EGFP cDNA (Table S6). Right illustration of R26-gRNA targeting the intron of the murine Gt(ROSA)26Sor gene . Both 0.66 kb dsDNA and 0.66 knt ssDNA, as well as both 1.36 kb dsDNA and 1.36 knt ssDNA, were utilized (Table S6). (b) (c) Table summarizes the efficiency of various sizes of DNA fragments about knock-in genome editing in the Ramp2 and Gt(ROSA)26Sor locus in fertilized eggs and two-cell embryos. They were electroporated with 100 ng/ µL of dsDNA or 50 ng/µL of ssDNA along with 200 ng/µL of guide RNA and 50 ng/µL of Cas9 protein. Each experiment was conducted at least three times.

    Article Snippet: Finally, 1.8 knt of ssDNA were prepared from the dsDNA using the Guide-itTM Long ssDNA Production kit (Takara Bio Inc., Shiga, Japan).

    Techniques: Knock-In, Modification, Sequencing